> For the complete documentation index, see [llms.txt](https://help.tso500software.illumina.com/llms.txt). Markdown versions of documentation pages are available by appending `.md` to page URLs; this page is available as [Markdown](https://help.tso500software.illumina.com/dragen-tso-500-guides/mtap-spike-in-resources/bcl-conversion-for-supplementary-analysis.md).

# BCL conversion for supplementary analysis

## Generating FASTQs using BCL Convert

FASTQs can be generated using TSO 500 or BCL Convert. When starting analysis from TSO 500, follow the [DRAGEN TSO 500 v2.6](/dragen-tso-500-guides/dragen-tso-500-v2.6.md) guide, and go to [Supplemental CNV analysis using DRAGEN Enrichment](/dragen-tso-500-guides/mtap-spike-in-resources/supplemental-cnv-analysis-using-dragen-enrichment.md) for additional analysis. When generating FASTQs with BCL Convert, the following \[BCLConvert\_Settings] and \[BCLConvert\_Data] should be used to generate FASTQs with BCL Convert for subsequent launch of TSO 500 and DRAGEN Enrichment from FASTQ. BCL Convert pipeline versions 3.9.10 and 4.4.10 were tested upstream of TSO 500 and DRAGEN Enrichment analyses, and all BCL Convert versions 3.9.10 and newer are expected to be compatible. For more information on launching BCL Convert, see the [BCL Conversion](https://help.dragen.illumina.com/dragen-v4.4/product-guide/dragen-v4.4/bcl-conversion) support page.

### \[BCLConvert\_Settings]

| Sample Parameter         | Required | Details                                                                                                                                                                                                                                                                                                                                                        |
| ------------------------ | -------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| SoftwareVersion          | Required | The DRAGEN component software version. For example, TruSight Oncology 500 2.6.0 requires `3.10.17`. To ensure you are using the latest compatible version, refer to the software release notes.                                                                                                                                                                |
| AdapterRead1             | Required | <p>If using <strong>TSO 500</strong> Library Prep Kit (with UP or CP indexes):<br>AGATCGGAAGAGCACACGTCTGAACTCCAGTCA<br><br>If using <strong>TSO 500 HT</strong> Library Prep Kit (with UDP indexes):<br>CTGTCTCTTATACACATCTCCGAGCCCACGAGAC<br></p><p>If using <strong>TSO500 v2</strong> Library Prep Kit (with UCP v3 indexes):</p><p>CTGTCTCTTATACACATCT</p> |
| AdapterRead2             | Required | <p>If using <strong>TSO 500</strong> Library Prep Kit:<br>AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT<br><br>If using <strong>TSO 500 HT</strong> Library Prep Kit:<br>CTGTCTCTTATACACATCTGACGCTGCCGACGA</p><p>If using <strong>TSO500 v2</strong> Library Prep Kit:</p><p>CTGTCTCTTATACACATCT</p>                                                                       |
| AdapterBehavior          | Required | Enter `trim` This indicates that the BCL Convert software trims the specified adapter sequences from each read.                                                                                                                                                                                                                                                |
| MinimumTrimmedReadLength | Required | Enter `35`. Reads with a length trimmed below this point are masked.                                                                                                                                                                                                                                                                                           |
| MaskShortReads           | Required | Enter `35`. Reads with a length trimmed below this point are masked.                                                                                                                                                                                                                                                                                           |
| OverrideCycles           | Required | U7N1Y93;I10;I10;U7N1Y93                                                                                                                                                                                                                                                                                                                                        |

### \[BCLConvert\_Data]

| Sample Parameter | Required                                                                       | Details                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         |
| ---------------- | ------------------------------------------------------------------------------ | --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| Sample\_ID       | Required                                                                       | <p>The unique ID to identify a sample. The sample ID is included in the output file names.<br><br>Sample IDs must have the following characteristics:</p><ul><li>Case-insensitive unique values</li><li>1 to 40 characters</li><li>Alphanumeric, dash, and underscore characters only</li><li>An underscore or dash must have an alphanumeric character immediately before and after</li><li>Cannot be called <code>all</code>, <code>default</code>, <code>none</code>, <code>unknown</code>, <code>undetermined</code>, <code>stats</code>, or <code>reports</code>.</li><li>Each sample must have a unique combination of Lane (if applicable), sample ID, and index ID or the analysis will fail.</li></ul> |
| Index            | Required                                                                       | Index 1 sequence valid for Index\_ID assigned to matching Sample\_ID in the TSO 500 Data section.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               |
| Index2           | Required                                                                       | Index 2 sequence valid for Index\_ID assigned to matching Sample\_ID in the TSO 500 Data section.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               |
| Lane             | Not Required. Only for NovaSeq 6000 XP, NovaSeq 6000Dx, or NovaSeq X workflows | <p>Indicates which lane corresponds to a given sample. Enter a single numeric value per row.<br>Cannot be empty, i.e the analysis fails if the Lane column is present without a value in each row.</p>                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          |

For all other sample sheet requirements (sample IDs, indexes, TSO 500 data sections, and launching TSO 500 from FASTQ), refer to [Sample Sheet Requirements](/dragen-tso-500-guides/dragen-tso-500-v2.6/run-planning/sample-sheet-requirements.md).

### Sample sheet templates

TSO 500 sample sheet templates are available on [Sample Sheet Templates](/dragen-tso-500-guides/dragen-tso-500-v2.6/run-planning/sample-sheet-templates.md). When starting form BCL Convert, \[TSO500\_Settings] and \[TSO500\_Data] are not required.


---

# Agent Instructions
This documentation is published with GitBook. GitBook is the documentation platform designed so that both humans and AI agents can read, navigate, and reason over technical content effectively. Learn more at gitbook.com.

## Querying This Documentation
If you need additional information that is not directly available in this page, you can query the documentation by asking a question.

Perform an HTTP GET request on the following URL with the `ask` and `goal` query parameters:

```
GET https://help.tso500software.illumina.com/dragen-tso-500-guides/mtap-spike-in-resources/bcl-conversion-for-supplementary-analysis.md?ask=<question>&goal=<user_goal>
```

`ask` is the immediate question: it should be specific, self-contained, and written in natural language.
`goal` is what the user is ultimately trying to achieve, the reason they need the answer. Sharing it helps GitBook give you a better, more relevant answer. A goal is most helpful when it describes the outcome the user wants rather than restating the question. For example, with `ask=how do I create an API token`, a goal like `automate deployments from our CI pipeline` lets GitBook tailor the answer to that use case.

The response will contain a direct answer to the question and relevant excerpts and sources from the documentation.

Use this mechanism when the answer is not explicitly present in the current page, you need clarification or additional context, or you want to retrieve related documentation sections.