# Sample Sheet Requirements

## Standard Sample Sheet Requirements

The following sample sheet requirements describe required and optional fields for DRAGEN TSO 500 Analysis Software. Depending on the deployment (standalone DRAGEN server, ICA with auto-launch, ICA with manual launch, NovaSeq 6000Dx analysis application), certain sections and required values can deviate from the standard requirements. These deviations are noted in the information below.

{% hint style="warning" %}
The analysis fails if the sample sheet requirements are not met.
{% endhint %}

Use the following steps to create a valid sample sheet.

1. Download the [sample sheet v2 template](https://help.tso500software.illumina.com/dragen-tso-500-guides/dragen-tso-500-v2.6/run-planning/sample-sheet-templates) that matches the instrument & assay run.
2. In the Sequencing Settings section, enter the following required parameters:

### \[Sequencing\_Settings] Section

| Sample Parameter | Required | Details                                                                                                                                                                                                                                           |
| ---------------- | -------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| LibraryPrepKits  | Required | <p>Accepted values are:</p><ul><li>TSO500 (for UP or CP indexes)</li><li>TSO500HT (for UDP indexes)</li><li>TSO500\_v2 (for UDP v3 indexes)<br><br>Analysis results may be compromised if this value does not match the index set used.</li></ul> |

3. In the BCL Convert Settings section, enter the following required parameters:

### \[BCLConvert\_Settings] Section

| Sample Parameter         | Required | Details                                                                                                                                                                                                                                                                                                                                                        |
| ------------------------ | -------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| SoftwareVersion          | Required | <p>The DRAGEN component software version. For example,<br>TruSight Oncology 500 2.6.0 requires <code>3.10.17</code>. To ensure you are using the latest compatible version, refer to the software release notes.</p>                                                                                                                                           |
| AdapterRead1             | Required | <p>If using <strong>TSO 500</strong> Library Prep Kit (with UP or CP indexes):<br>AGATCGGAAGAGCACACGTCTGAACTCCAGTCA<br><br>If using <strong>TSO 500 HT</strong> Library Prep Kit (with UDP indexes):<br>CTGTCTCTTATACACATCTCCGAGCCCACGAGAC<br></p><p>If using <strong>TSO500 v2</strong> Library Prep Kit (with UCP v3 indexes):</p><p>CTGTCTCTTATACACATCT</p> |
| AdapterRead2             | Required | <p>If using <strong>TSO 500</strong> Library Prep Kit:<br>AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT<br><br>If using <strong>TSO 500 HT</strong> Library Prep Kit:<br>CTGTCTCTTATACACATCTGACGCTGCCGACGA</p><p>If using <strong>TSO500 v2</strong> Library Prep Kit:</p><p>CTGTCTCTTATACACATCT</p>                                                                       |
| AdapterBehavior          | Required | Enter `trim` This indicates that the BCL Convert software trims the specified adapter sequences from each read.                                                                                                                                                                                                                                                |
| MinimumTrimmedReadLength | Required | Enter `35`. Reads with a length trimmed below this point are masked.                                                                                                                                                                                                                                                                                           |
| MaskShortReads           | Required | Enter `35`. Reads with a length trimmed below this point are masked.                                                                                                                                                                                                                                                                                           |

4. In the BCL Convert Data section, enter the following parameters for each sample:

### \[BCLConvert\_Data] Section

{% hint style="warning" %}
Mismatches between the samples and index primers can cause incorrect results due to loss of positive sample identification. Enter sample IDs and assign indexes in the sample sheet before beginning library preparation. Record sample IDs, indexes, and plate well orientation for reference during library preparation.
{% endhint %}

| Sample Parameter | Required                                                                       | Details                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         |
| ---------------- | ------------------------------------------------------------------------------ | --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| Sample\_ID       | Required                                                                       | <p>The unique ID to identify a sample. The sample ID is included in the output file names.<br><br>Sample IDs must have the following characteristics:</p><ul><li>Case-insensitive unique values</li><li>1 to 40 characters</li><li>Alphanumeric, dash, and underscore characters only</li><li>An underscore or dash must have an alphanumeric character immediately before and after</li><li>Cannot be called <code>all</code>, <code>default</code>, <code>none</code>, <code>unknown</code>, <code>undetermined</code>, <code>stats</code>, or <code>reports</code>.</li><li>Each sample must have a unique combination of Lane (if applicable), sample ID, and index ID or the analysis will fail.</li></ul> |
| Index            | Required                                                                       | Index 1 sequence valid for Index\_ID assigned to matching Sample\_ID in the TSO 500 Data section.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               |
| Index2           | Required                                                                       | Index 2 sequence valid for Index\_ID assigned to matching Sample\_ID in the TSO 500 Data section.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               |
| Lane             | Not Required. Only for NovaSeq 6000 XP, NovaSeq 6000Dx, or NovaSeq X workflows | <p>Indicates which lane corresponds to a given sample. Enter a single numeric value per row.<br>Cannot be empty, i.e the analysis fails if the Lane column is present without a value in each row.</p>                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          |

5. In the TSO 500 Data section, enter the following parameters:

{% hint style="info" %}
TSO 500 Data Section header changes depending on the deployment:

* Standalone DRAGEN Server and ICA with Manual Launch: `TSO500S_Data`
* ICA with Auto-launch: `Cloud_TSO500S_Data`
* Illumina DRAGEN TruSight Oncology 500 (HRD) Analysis Application on NovaSeq 6000Dx: `TSO500HRD_Data`
  {% endhint %}

### \[TSO500S\_Data] Section

| Sample Parameter    | Required                           | Details                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            |
| ------------------- | ---------------------------------- | ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| Sample\_ID          | Required                           | <p>The unique ID to identify a sample. The sample ID is included in the output file names. Sample IDs are not case sensitive. Sample IDs must have the following characteristics:<br>- Unique for the run.<br>- 1–40 characters.<br>- No spaces.<br>- Alphanumeric characters with underscores and dashes. If you use an underscore or dash, enter an alphanumeric character before and after the underscore or dash. eg, Sample1-T5B1\_022515.<br>- Cannot be called <code>all</code>, <code>default</code>, <code>none</code>, <code>unknown</code>, <code>undetermined</code>, <code>stats</code>, or <code>reports</code>.<br>- Must match a Sample\_ID listed in the BCLConvert data section.<br>- Illumina recommends that the sample ID be based on the pair ID. Example: <code>\<Pair\_ID>-DNA,\<Pair\_ID>-RNA.</code></p> |
| Sample\_Type        | Required                           | <p>Enter <code>DNA</code> or <code>RNA</code>.<br>For HRD samples, this parameter must be <code>DNA</code>.</p>                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    |
| Pair\_ID            | Required                           | <p>A unique ID that links DNA and RNA from the same biological sample from the same individual. Pair ID shares, at most, one DNA and one RNA sample per run. eg, if a Sample\_ID is <code>TestSample1-DNA</code> for DNA and <code>TestSample1-RNA</code> for RNA, the Pair\_ID <code>TestSample1</code> will link these samples that are on different rows in the sample sheet together.<br>If the pair ID is associated with more than one DNA or RNA sample, the analysis fails.</p>                                                                                                                                                                                                                                                                                                                                            |
| Sample\_Feature     | Required when using HRD add-on kit | <p>Required for HRD enriched samples.<br>For DNA samples that have undergone HRD enrichment, enter <code>HRD</code> in this column of the sample sheet. If the sample has not undergone HRD enrichment, leave the field empty.</p>                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 |
| Sample\_Description | Not Required                       | <p>Sample description must meet the following requirements:<br>- 1–50 characters.<br>- Alphanumeric characters with underscores, dashes and spaces. If you enter a underscore, dash, or space, enter an alphanumeric character before and after. eg, Solid-FFPE\_213.</p>                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          |

To ensure a successful analysis, follow these guidelines:

1. Avoid any blank lines at the end of the sample sheet; these can cause the analysis to fail.
2. When running local analysis, using the command line, save the sample sheet in the sequencing run folder with the default name `SampleSheet.csv`, or choose a different name and specify the path in the command-line options.

## ICA with Auto-launch: Sample Sheet Requirements

Refer to the following requirements to create sample sheets for running the analysis on ICA with Auto-launch. For sample sheet requirements common between deployments see [Standard Sample Sheet Requirements](#standard-sample-sheet-requirements). Samples sheets can be created using BaseSpace Run Planning Tool or manually by downloading and editing a sample sheet template.

{% hint style="info" %}
To auto-launch analysis from the sequencer run folder, ensure the StartsFromFastq and SampleSheetRequested fields are set to FALSE. To auto-launch analysis from FASTQs after BCL Convert auto-launch, StartsFromFastq and SampleSheet Requested fields must be set to TRUE
{% endhint %}

### **\[Cloud\_TSO500S\_Data] Section**

Refer to [\[TSO500\_Data\] Section](#tso-500-data) for this section's requirements.

### **\[Cloud\_TSO500S\_Settings] Section**

| Parameters           | Required     | Details                                                                                                                                                                  |
| -------------------- | ------------ | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------ |
| SoftwareVersion      | Not Required | The TSO500S software version.                                                                                                                                            |
| StartsFromFastq      | Required     | Set the value to TRUE or FALSE. To auto-launch from BCL files, set to FALSE. To auto-launch from FASTQ files after auto-launch of BCL Convert, set to TRUE.              |
| SampleSheetRequested | Required     | <p>Set the value to TRUE or FALSE.</p><p>To auto-launch from BCL files, set to FALSE. To auto-launch from FASTQ files after auto-launch of BCL Convert, set to TRUE.</p> |

### \[Cloud\_Data] Section

| Parameters          | Required     | Details                                                                                    |
| ------------------- | ------------ | ------------------------------------------------------------------------------------------ |
| Sample\_ID          | Not Required | The same sample ID used in the Cloud\_TSO500S\_Data section.                               |
| ProjectName         | Not Required | The BaseSpace project name.                                                                |
| LibraryName         | Not Required | Combination of sample ID and index values in the following format: sampleID\_Index\_Index2 |
| LibraryPrepKitName  | Required     | The Library Prep Kit used.                                                                 |
| IndexAdapterKitName | Not Required | The Index Adapter Kit used.                                                                |

### \[Cloud\_Settings] Section

| Parameter               | Required     | Details                                                                                                                                                                                                                                                                                                                                                       |
| ----------------------- | ------------ | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| GeneratedVersion        | Not Required | The cloud GSS version used to create the sample sheet. Optional if manually updating a sample sheet.                                                                                                                                                                                                                                                          |
| CloudWorkflow           | Not Required | Ica\_workflow\_1                                                                                                                                                                                                                                                                                                                                              |
| Cloud\_TSO500\_Pipeline | Required     | <p>This value is a universal record number (URN) . The valid values are:</p><p>v2.6.0.8 (F2 compatible, includes HRD)<br>urn:ilmn:ica:pipeline:142fb3af-f0aa-41f2-b043-f2913671e0b4#DRAGEN\_TruSight\_Oncology\_500\_v2\_6\_0\_8<br><br>v2.6.2<br>urn:ilmn:ica:pipeline:b4dec62d-f3af-4dc3-8d15-6fe6c9a4df6c#DRAGEN\_TruSight\_Oncology\_500\_v2\_6\_2\_4</p> |
| BCLConvert\_Pipeline    | Required     | urn:ilmn:ica:pipeline:a0778b16-f318-40df-ae04-95998e3a7564#BCL\_Convert\_v3\_10\_9\_for\_TSO500                                                                                                                                                                                                                                                               |

## NovaSeq 6000Dx Analysis Application: Sample Sheet Requirements

This section describes fields specific for sample sheets for NovaSeq 6000Dx Analysis Application. For more information on DRAGEN TSO 500 Analysis Software sample sheet requirements, refer to the sections above.

### \[BCLConvert\_Settings] Section

| Parameter Name  | Required |                                                  |
| --------------- | -------- | ------------------------------------------------ |
| SoftwareVersion | Required | Enter the IRM iapp software version 2.6.0-2v12ui |

### \[TSO500S\_Data] Section

Refer to \[[TSO500S\_Data\] Section](#tso500s_data-section) for this section's requirements.
