DRAGEN TSO 500 and TSO 500 ctDNA Analysis Software
  • DRAGEN TSO 500 and TSO 500 ctDNA Analysis Software
  • DRAGEN TSO 500 Guides
    • DRAGEN TSO 500 v2.6
      • Introduction to DRAGEN TSO 500 Analysis Software v2.6.x
      • Getting Started
        • Installation of 2.6.0 on Standalone DRAGEN Server
        • Installation of 2.6.1 on Standalone DRAGEN Server
        • Getting Started on Illumina Connected Analytics
        • Installation of NovaSeq 6000Dx TSO 500 Analysis Application
      • Run Planning
        • Sample Sheet Introduction
        • Sample Sheet Requirements
        • Sample Sheet Creation in BaseSpace Run Planning tool
        • NovaSeq 6000Dx Run Set Up
        • Sample Sheet Templates
      • Launching Analysis
        • Analysis Launch on Standalone DRAGEN Server
          • Command-Line Options
          • Run on Multiple DRAGEN Servers
        • Analysis Launch on ICA
          • Auto-Launch of DRAGEN TSO 500 Analysis on ICA
          • Manual Launch of DRAGEN TSO 500 Analysis on ICA
      • Analysis Output
        • DNA Output
        • RNA Output
        • Combined Variant Output
        • Metrics Output
          • DNA Expanded Metrics
          • RNA Expanded Metrics
          • HRD Metrics Report
        • Coverage Reports
        • Block List
      • Analysis Methods
        • FastQ Generation
        • DNA Analysis Methods
        • RNA Analysis Methods
        • Quality Control
        • Performance Testing
      • Troubleshooting
    • DRAGEN TSO 500 v2.5
      • Introduction to DRAGEN TSO 500 Analysis Software v2.5.x
      • Getting Started
        • Installation of 2.5.3 on Standalone DRAGEN Server
        • Installation of v2.5.4 on Standalone DRAGEN Server
        • Getting Started on Illumina Connected Analytics
      • Run Planning
        • Sample Sheet Introduction
        • Sample Sheet Requirements
        • Sample Sheet Creation in BaseSpace Run Planning tool
        • Sample Sheet Templates
      • Launching Analysis
        • Analysis Launch on Standalone DRAGEN Server
          • Command-Line Options
          • Run on Multiple DRAGEN Servers
        • Analysis Launch on ICA
          • Auto-Launch of DRAGEN TSO 500 Analysis on ICA
          • Manual Launch of DRAGEN TSO 500 Analysis on ICA
      • Analysis Output
        • DNA Output
        • RNA Output
        • Combined Variant Output
        • Metrics Output
          • DNA Expanded Metrics
          • RNA Expanded Metrics
          • HRD Metrics Report
          • Block List
        • Analysis Methods
          • FASTQ Generation
          • DNA Analysis Methods
          • RNA Analysis Methods
          • Quality Control
          • Performance Testing
      • Troubleshooting
  • DRAGEN TSO 500 ctDNA Guides
    • DRAGEN TSO 500 ctDNA v2.6
      • Introduction to DRAGEN TSO 500 ctDNA Analysis Software v2.6
      • Getting Started
        • Installation of TSO 500 ctDNA v2.6.0 on Standalone DRAGEN Server
        • Installation of TSO 500 ctDNA v2.6.2 on Standalone DRAGEN Server
        • Getting Started on Illumina Connected Analytics
        • Installation of NovaSeq 6000Dx TSO 500 ctDNA Analysis Application
      • Run Planning
        • Sample Sheet Introduction
        • Sample Sheet Requirements
        • Sample Sheet Creation in BaseSpace Run Planning tool
        • NovaSeq 6000Dx Run Set Up
        • Sample Sheet Templates
      • Launching Analysis
        • Analysis Launch on Standalone DRAGEN Server
          • Command-Line Options
        • Analysis Launch on ICA
          • Auto-Launch of DRAGEN TSO 500 ctDNA Analysis on ICA
          • Manual Launch of DRAGEN TSO 500 ctDNA Analysis on ICA
      • Analysis Output
        • DNA Output
        • Combined Variant Output
        • Metrics Output
          • DNA Expanded Metrics
        • Coverage Reports
        • Block List
      • Analysis Methods
        • FastQ Generation
        • DNA Analysis Methods
        • Quality Control
      • Troubleshooting
  • Reference
    • Revision History
Powered by GitBook
On this page
  • Standard Sample Sheet Requirements
  • [BCLConvert_Settings] Section
  • [BCLConvert_Data] Section
  • [TSO500S_Data] Section
  • ICA with Auto-launch: Sample Sheet Requirements
  • [Cloud_TSO500S_Data] Section
  • [Cloud_TSO500S_Settings] Section
  • [Cloud_Data] Section
  • [Cloud_Settings] Section

Was this helpful?

Export as PDF
  1. DRAGEN TSO 500 Guides
  2. DRAGEN TSO 500 v2.5
  3. Run Planning

Sample Sheet Requirements

DRAGEN TSO 500 Analysis Software has optional and required fields that are required in addition to general sample sheet requirements. Follow the steps below to create a valid samplesheet.

Standard Sample Sheet Requirements

The following sample sheet requirements describe required and optional fields for DRAGEN TSO 500 Analysis Software. Depending on the deployment (standalone DRAGEN server, ICA with auto-launch, ICA with manual launch), certain sections and required values can deviate from the standard requirements. These deviations are noted in the information below.

The analysis fails if the sample sheet requirements are not met.

Use the following steps to create a valid sample sheet.

  1. Download the sample sheet v2 template that matches the instrument & assay run.

  2. In the BCL Convert Settings section, enter the following required parameters:

[BCLConvert_Settings] Section

Sample Parameter
Required
Details

SoftwareVersion

Required

The DRAGEN component software version. For DRAGEN TSO 500 v2.5.3 and v2.5.4 specify 3.10.16.

AdapterRead1

Required

If using 8 bp indexes starting with UP or CP (used with TSO 500): AGATCGGAAGAGCACACGTCTGAACTCCAGTCA If using 10 bp indexes with UDP (used with TSO 500 HT): CTGTCTCTTATACACATCTCCGAGCCCACGAGAC Analysis fails if the incorrect adapter sequences are used

AdapterRead2

Required

If using 8 bp indexes starting with UP or CP (used with TSO 500): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT If using 10 bp indexes with UDP (used with TSO 500 HT): CTGTCTCTTATACACATCTGACGCTGCCGACGA Analysis fails if the incorrect adapter sequences are used

AdapterBehavior

Required

Enter trim This indicates that the BCL Convert software trims the specified adapter sequences from each read.

MinimumTrimmedReadLength

Required

Enter 35. Reads with a length trimmed below this point are masked.

MaskShortReads

Required

Enter 35. Reads with a length trimmed below this point are masked.

  1. In the BCL Convert Data section, enter the following parameters for each sample.

[BCLConvert_Data] Section

Sample Parameter
Required
Details

Sample_ID

Required

Must match a Sample_ID listed in the TSO 500 Data section.

Index

Required

Index 1 sequence valid for Index_ID assigned to matching Sample_ID in the TSO 500 Data section.

Index2

Required

Index 2 sequence valid for Index_ID assigned to matching Sample_ID in the TSO 500 Data section.

Lane

Only for NovaSeq 6000 XP, NovaSeq 6000Dx, or NovaSeq X workflows

Indicates which lane corresponds to a given sample. Enter a single numeric value per row. Cannot be empty, i.e the analysis fails if the Lane column is present without a value in each row.

  1. In the TSO 500 Data section, enter the following parameters:

TSO 500 Data Section header changes depending on the deployment:

  • Standalone DRAGEN Server and ICA with Manual Launch: TSO500S_Data

  • ICA with Auto-launch: Cloud_TSO500S_Data

[TSO500S_Data] Section

Sample Parameter
Required
Details

Sample_ID

Required

The unique ID to identify a sample. The sample ID is included in the output file names. Sample IDs are not case sensitive. Sample IDs must have the following characteristics: - Unique for the run. - 1–40 characters. - No spaces. - Alphanumeric characters with underscores and dashes. If you use an underscore or dash, enter an alphanumeric character before and after the underscore or dash. eg, Sample1-T5B1_022515. - Cannot be called all, default, none, unknown, undetermined, stats, or reports. - Must match a Sample_ID listed in the TSO 500 Data section. - Illumina recommends that the sample ID be based on the pair ID. Example: <Pair_ID>-DNA,<Pair_ID>-RNA. - Each sample must have a unique combination of Lane (if applicable), sample ID, and index ID or the analysis will fail.

Sample_Type

Required

Enter DNA or RNA. For HRD samples, this parameter must be DNA.

Pair_ID

Required

A unique ID that links DNA and RNA from the same biological sample from the same individual. Pair ID shares, at most, one DNA and one RNA sample per run. eg, if a Sample_ID is TestSample1-DNA for DNA and TestSample1-RNA for RNA, the Pair_ID TestSample1 will link these samples that are on different rows in the sample sheet together. If the pair ID is associated with more than one DNA or RNA sample, the analysis fails.

Sample_Feature

Required when using HRD add-on kit

Required for HRD enriched samples. For DNA samples that have undergone HRD enrichment, enter HRD in this column of the sample sheet. If the sample has not undergone HRD enrichment, leave the field empty.

Sample_Description

Not Required

Sample description must meet the following requirements: - 1–50 characters. - Alphanumeric characters with underscores, dashes and spaces. If you enter a underscore, dash, or space, enter an alphanumeric character before and after. eg, Solid-FFPE_213.

To ensure a successful analysis, follow these guidelines:

  1. Avoid any blank lines at the end of the sample sheet; these can cause the analysis to fail.

  2. When running local analysis using the command line save the sample sheet in the sequencing run folder with the default name SampleSheet.csv, or choose a different name and specify the path in the command-line options.

ICA with Auto-launch: Sample Sheet Requirements

[Cloud_TSO500S_Data] Section

[Cloud_TSO500S_Settings] Section

Parameters
Required
Details

SoftwareVersion

Not Required

The TSO500S software version

StartsFromFastq

Required

Set the value to TRUE or FALSE. To auto-launch from BCL files, set to FALSE.

[Cloud_Data] Section

Parameters
Required
Details

Sample_ID

Not Required

The same sample ID used in the Cloud_TSO500S_Data section.

ProjectName

Not Required

The BaseSpace project name.

LibraryName

Not Required

Combination of sample ID and index values in the following format: sampleID_Index_Index2

LibraryPrepKitName

Not Required

The Library Prep Kit used.

IndexAdapterKitName

Not Required

The Index Adapter Kit used.

[Cloud_Settings] Section

Parameter
Required
Details

GeneratedVersion

Not Required

The cloud GSS version used to create the sample sheet. Optional if manually updating a sample sheet.

CloudWorkflow

Not Required

Ica_workflow_1

Cloud_TSO500_Pipeline

Required

This value is a universal record number (URN). The valid values are:

  • Solid—urn:ilmn:ica:pipeline:e8eff7ef-1683-4f63-a0ba-9af542cd39e0#DRAGEN_TSO500_RUO_TISSUE_HT_v2_5_2_1_Pipeline

  • Solid HRD —urn:ilmn:ica:pipeline:172270e9-3678-45a9-a9f4-c9c7a0a32bb8#DRAGEN_TSO500_RUO_TISSUE_HRD_v2_5_2_1_Pipeline

BCLConvert_Pipeline

Required

The value is a URN in the following format: urn:ilmn:ica:pipeline: <pipeline-ID>#<pipeline-name>

PreviousSample Sheet IntroductionNextSample Sheet Creation in BaseSpace Run Planning tool

Last updated 5 months ago

Was this helpful?

Refer to the following requirements to create sample sheets for running the analysis on ICA with Auto-launch. For sample sheet requirements common between deployments see . Samples sheets can be created using BaseSpace Run Planning Tool or manually by downloading and editing a sample sheet template

Refer to for this section's requirements.

Standard Sample Sheet Requirements
[TSO500_Data] Section